ID: 1200754469

View in Genome Browser
Species Human (GRCh38)
Location Y:6977300-6977322
Sequence TGTCATCTGTCAACAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200754469_1200754471 -9 Left 1200754469 Y:6977300-6977322 CCTCCTGTTGTTGACAGATGACA 0: 1
1: 1
2: 1
3: 9
4: 111
Right 1200754471 Y:6977314-6977336 CAGATGACACCTGCACAATCAGG 0: 2
1: 1
2: 17
3: 770
4: 1815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200754469 Original CRISPR TGTCATCTGTCAACAACAGG AGG (reversed) Intronic
903158988 1:21471314-21471336 TCTCTTCTGTCAACAAAAGTAGG - Intronic
910911812 1:92242845-92242867 TGTCATTTCTCAAGCACAGGTGG - Intronic
911439563 1:97908416-97908438 TGTCATCTACCAACCCCAGGGGG + Intronic
912509395 1:110178118-110178140 TGTAATCTGTTAAAAACAGTTGG - Intronic
919026536 1:192178552-192178574 TTTCATCTCTCCACAACAGCAGG - Intronic
922683707 1:227622552-227622574 TGGCTTCTTTCATCAACAGGAGG + Intronic
924572413 1:245249063-245249085 TGGCAGCTGTCTATAACAGGTGG + Intronic
1062996039 10:1868593-1868615 TGTCCACTGTCAACAACAGTGGG - Intergenic
1063721637 10:8588347-8588369 TTTTTTCTGTCAACAAAAGGAGG + Intergenic
1067119469 10:43461871-43461893 TGTCATTTGTCATCCCCAGGTGG + Intronic
1072043888 10:91635582-91635604 TGGCATTAGTCAACACCAGGGGG - Intergenic
1072587625 10:96796736-96796758 TGTCAGATGTTAACAATAGGGGG - Intergenic
1073666233 10:105537133-105537155 ACTCATCTGTCAAAAATAGGTGG + Intergenic
1074917590 10:117972251-117972273 TGTCATTTGTCAAGAACAGGAGG - Intergenic
1074942615 10:118249674-118249696 TGCCATCTCTCATCACCAGGAGG + Intergenic
1075869430 10:125759078-125759100 TGTCATAGGTCTACAGCAGGAGG + Intronic
1078574365 11:12486129-12486151 TGTGAGCTGTTAACAATAGGAGG + Intronic
1079737846 11:24019527-24019549 TGTCATCTCTCAACATCCTGGGG - Intergenic
1086351319 11:85944959-85944981 CCTCATCTGTCAACAGAAGGAGG - Intergenic
1086448010 11:86888398-86888420 TGCCATATTTCAACAACTGGGGG + Intronic
1086721584 11:90128014-90128036 TGTCCTCTTTCAGCCACAGGTGG + Intergenic
1088788125 11:113200974-113200996 TGTCATCTGTGAAAATCAGAGGG - Intronic
1090307376 11:125703000-125703022 TGTAAGCTGTTAACAACAGGGGG + Intergenic
1092163145 12:6327281-6327303 TGTCTTCTGTCACCACCAGGTGG - Exonic
1093092554 12:14937864-14937886 TGCCATCTGCCAGCAGCAGGTGG + Intronic
1094304292 12:29000486-29000508 TGTCATCTCCCAATAAGAGGTGG + Intergenic
1096877070 12:54637807-54637829 TGTCACCTGACAACAAGAGATGG - Intergenic
1099165341 12:79299654-79299676 TATCAGCTGTCAACAACTAGAGG - Intronic
1099637883 12:85238828-85238850 TGTCATCTGTGAAAATCAGATGG - Intronic
1102629060 12:114260997-114261019 TGTCACCTGTCAACTATAGATGG - Intergenic
1106100083 13:26686981-26687003 TTTAATGTGCCAACAACAGGAGG - Exonic
1109599271 13:64601802-64601824 TGTCATCTGTAATAAACAGGTGG + Intergenic
1110251555 13:73386119-73386141 TGACATCAGTCAACAACTAGTGG + Intergenic
1111601175 13:90476528-90476550 TGACATCTGTCAAAAACCTGAGG + Intergenic
1114683835 14:24508846-24508868 TCTCTTCTGTCAAAAACATGTGG - Intergenic
1115306122 14:31935647-31935669 TGTCATCTGCCCCCAGCAGGAGG + Intergenic
1116574831 14:46559935-46559957 TGTCTTCAGTCAAAAAGAGGAGG - Intergenic
1126413247 15:48393717-48393739 GCTCAACTGTCAACAACTGGGGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131437389 15:92434278-92434300 TTACTTCTGTCAACAACAGCTGG - Exonic
1144213590 17:13035336-13035358 TTTCATATTTCAACAACAGGAGG - Intergenic
1148023293 17:44568033-44568055 TGTCACCTCTCAAAAACACGTGG - Intergenic
1149398452 17:56269522-56269544 TGTCCTCTCTCAACTACATGAGG + Intronic
1152630184 17:81407466-81407488 TGCCATGTGTTAAGAACAGGAGG - Intronic
1154319781 18:13338422-13338444 TGTCAAGAGTCAACAACAGCAGG - Intronic
1160446341 18:78929953-78929975 TGCCGGCTGACAACAACAGGAGG + Intergenic
1167434256 19:49470031-49470053 TCACATCTGTTACCAACAGGAGG - Intronic
926706274 2:15840020-15840042 TGCCCACTGTCAACAACATGAGG - Intergenic
927373325 2:22383132-22383154 TGTCTTCTGTGGACAAAAGGAGG + Intergenic
928375088 2:30767426-30767448 GGTCATCTGTTAACAAAATGGGG + Intronic
947269653 2:228319779-228319801 ATTCATATGTCAAAAACAGGTGG - Intergenic
948728284 2:239947738-239947760 TGCCATCTGGCAACAAGAGCTGG - Intronic
1171974265 20:31584094-31584116 AGACATCTGTGAACAACAAGTGG - Intergenic
1174093640 20:48069922-48069944 TGTCAGCTGTCACCAGGAGGTGG - Intergenic
1176812839 21:13562059-13562081 TCTCATCTGTCATCAGCTGGAGG - Intergenic
1177457088 21:21354566-21354588 TGTGATCTGTGAACCACTGGGGG - Intronic
1179285912 21:39977189-39977211 TTACATCTGTCAAAATCAGGAGG - Intergenic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
949247582 3:1943159-1943181 TTACATCTAGCAACAACAGGGGG + Intergenic
951062261 3:18223049-18223071 TCCCATCTGTCAAAAACAGCTGG + Intronic
952072979 3:29661452-29661474 TGAGATCTATCAAAAACAGGAGG - Intronic
954655782 3:52193346-52193368 TGTCAGCTGTCAGCCACAGCTGG - Intergenic
956074153 3:65487074-65487096 TTTCATCTGGCAACCACAGTTGG - Intronic
958620411 3:96551260-96551282 TTTCAACTGTCACCATCAGGAGG - Intergenic
960482559 3:118211570-118211592 TGTTATCAGTCAACCACAGCAGG + Intergenic
960555514 3:119025053-119025075 TGTAATCTTTCTACAACAGATGG + Intronic
963106723 3:141653792-141653814 TTTCTTCTGGCACCAACAGGAGG - Intergenic
966124032 3:176554639-176554661 AGTGATCTGTCAAAAACAGTTGG - Intergenic
970383468 4:15531910-15531932 TCTTATCTGTCACCATCAGGTGG - Intronic
975604278 4:76137730-76137752 TGTCATCTTTCAACAAAGCGAGG + Intronic
975920896 4:79385991-79386013 TGTCAGCTATCACCAACAGCAGG - Intergenic
976484440 4:85585243-85585265 TGTCTTGTGTCAAAAACAGAAGG - Intronic
977991648 4:103450166-103450188 TGTCTCCTGTCAACACCATGAGG - Intergenic
980839829 4:138244897-138244919 TGTGATCTGACAACAACTGGTGG + Intergenic
981912953 4:150003271-150003293 AGCCATCTGTCAACAAGAGTTGG + Intergenic
983904810 4:173171017-173171039 TGTCATTTGTCAAAAACAAAAGG + Intronic
984238906 4:177193747-177193769 TGTCACCTCTCACCAACAAGTGG + Intergenic
984269321 4:177531667-177531689 TTTCAACTGTCAAGAACAGCAGG - Intergenic
984660462 4:182368811-182368833 TGACAGCTGTCAACTACAGATGG - Intronic
985706194 5:1402810-1402832 GGTCATCTGTGACCAAGAGGAGG - Intronic
986740697 5:10702755-10702777 TGGCAGCTGCCAACAACAGCTGG + Intronic
986916814 5:12629540-12629562 TATCATCTGTCCTCTACAGGTGG + Intergenic
991954617 5:71981473-71981495 TGTCTTCTGGCAAAAAAAGGGGG - Intergenic
994909620 5:105885910-105885932 TGTAAACTGTAAACCACAGGAGG - Intergenic
1004706276 6:18126833-18126855 TGTTAACTTTCGACAACAGGAGG - Intergenic
1006287537 6:33108372-33108394 TGTGAACTGTAAACATCAGGAGG - Intergenic
1007058843 6:38917592-38917614 TGACATCTGTCCAGAACCGGTGG + Intronic
1007566081 6:42851560-42851582 TGTGTTGTGTCAACATCAGGTGG - Intronic
1009907422 6:69887401-69887423 TGTAATATCTCAACAAAAGGAGG - Intronic
1010371255 6:75110638-75110660 TGTCATCTTTCAACAATAGAAGG + Intronic
1010906028 6:81490189-81490211 GGTCATCTCTCTAAAACAGGAGG + Intergenic
1013603188 6:111724401-111724423 TGTGGTCTGTCTACATCAGGAGG - Intronic
1015578123 6:134694340-134694362 TGTCATTTGCCAACAACATGAGG - Intergenic
1019852600 7:3574455-3574477 TGCCATCAGTTAACAACAGTAGG - Intronic
1020612211 7:10412610-10412632 TGTAATCTATGACCAACAGGTGG - Intergenic
1023640148 7:42249426-42249448 TGTCACCTTACAAAAACAGGTGG + Intergenic
1023831091 7:44039386-44039408 TGGCAAATGTCAACAGCAGGCGG + Intergenic
1024464296 7:49695001-49695023 TATCATCTGTCAAGAGCAAGAGG - Intergenic
1026066212 7:67075528-67075550 TGTCATCTGTCAATAAAAAGAGG + Intronic
1026585836 7:71655573-71655595 TCTCATCTGTAAATGACAGGGGG - Intronic
1027112615 7:75452895-75452917 TTGCATCTCTCACCAACAGGTGG + Intronic
1027284859 7:76637501-76637523 TTGCATCTCTCACCAACAGGTGG + Intergenic
1031339895 7:120586365-120586387 TGTCATTTGACAAAAACAAGAGG - Intronic
1033929334 7:146504527-146504549 CATCATCTGTCAACAGAAGGAGG + Intronic
1035606887 8:935299-935321 TGTCAGCTGCCAACCACATGCGG + Intergenic
1038300268 8:26338963-26338985 TGTCATCTTTCAACAGGAGCAGG + Exonic
1047105300 8:121724832-121724854 CTTCATCTGTGAATAACAGGAGG + Intergenic
1047191611 8:122683533-122683555 AGTCATCTGTCAACCCCAGATGG + Intergenic
1048331947 8:133476595-133476617 TGTCATCTGCAAAGAAAAGGAGG + Exonic
1049173810 8:141179113-141179135 TGGCATCTGTCACCAACTGCAGG + Intronic
1050592433 9:7174235-7174257 TGACATTTGTCAAAAACAGAGGG + Intergenic
1050605798 9:7299990-7300012 TGAGTTCTGTCAACAACATGAGG - Intergenic
1051467716 9:17399636-17399658 TATCATCTGTTTACAAAAGGTGG - Intronic
1056661782 9:88548952-88548974 TGCCATCTGTGAACAAGAAGTGG + Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1062550327 9:137083094-137083116 TGTCATCTGGGGAGAACAGGAGG + Exonic
1186438107 X:9560826-9560848 TGTCATCTGTCGACAACAGGAGG - Intronic
1186750985 X:12620721-12620743 TCTCATCAGTCAACAAGAGAAGG + Intronic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1191682575 X:63856432-63856454 TGTCATCTGCCAGCAGGAGGAGG - Intergenic
1198330009 X:135613721-135613743 TGGCATCTGGAAACAACAAGAGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1200754469 Y:6977300-6977322 TGTCATCTGTCAACAACAGGAGG - Intronic