ID: 1200761864

View in Genome Browser
Species Human (GRCh38)
Location Y:7046010-7046032
Sequence GTAAAAGTGTGACCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200761862_1200761864 3 Left 1200761862 Y:7045984-7046006 CCTTTTTTGATCAGGTTCTCACT 0: 3
1: 40
2: 52
3: 82
4: 316
Right 1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 134
1200761861_1200761864 4 Left 1200761861 Y:7045983-7046005 CCCTTTTTTGATCAGGTTCTCAC 0: 1
1: 2
2: 49
3: 72
4: 443
Right 1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 134
1200761858_1200761864 27 Left 1200761858 Y:7045960-7045982 CCCAGAATTTTGTTTTAAAAATT 0: 1
1: 13
2: 56
3: 276
4: 2027
Right 1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 134
1200761859_1200761864 26 Left 1200761859 Y:7045961-7045983 CCAGAATTTTGTTTTAAAAATTC 0: 1
1: 12
2: 33
3: 173
4: 1267
Right 1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200761864 Original CRISPR GTAAAAGTGTGACCAAAACC TGG Intronic
904855694 1:33496787-33496809 GTAAAATTGTGCCAAGAACCTGG - Intergenic
908483299 1:64565249-64565271 GTAAGAGGGTGAACTAAACCAGG - Intronic
908948618 1:69530664-69530686 GTAAAAGTGTGTGAAATACCTGG + Intergenic
910227660 1:84952594-84952616 GTGAAAGTGTGACAAGAAGCAGG + Intronic
910794372 1:91083402-91083424 GTAAAAGAATGACCACAATCAGG - Intergenic
911752330 1:101509884-101509906 GTAAAAATGTATCCAAAACATGG + Intergenic
912016738 1:105047449-105047471 GTGAGAGTGTGACCAAAGCTTGG + Intergenic
919773780 1:201180161-201180183 GTAAAAGTGGGATTTAAACCTGG + Intergenic
922629097 1:227085812-227085834 GTAAAAGTGTGAAAAAAAACTGG - Intronic
922758970 1:228112938-228112960 GTGAGAGTGTGACCAAAACTTGG + Intergenic
1062916971 10:1248022-1248044 GTAAAAATGTGCCCAAAGCCAGG + Intronic
1064612897 10:17122320-17122342 GTCAAAATGTGACCATAACGAGG - Intronic
1065725583 10:28665160-28665182 GGAAAAGTGTTAGCAAAAGCAGG + Intergenic
1066124408 10:32325942-32325964 GTTAAAGTCTGACCAAATCATGG + Intronic
1067481335 10:46600662-46600684 GTGAAAGAGAAACCAAAACCAGG + Intergenic
1067613416 10:47741065-47741087 GTGAAAGAGAAACCAAAACCAGG - Intergenic
1070641922 10:78176579-78176601 GCAAAACTGAGACCAAAACCTGG + Intergenic
1070753678 10:78978367-78978389 GAAACAGCGTGAACAAAACCAGG - Intergenic
1071628822 10:87201164-87201186 GTGAAAGAGAAACCAAAACCAGG - Intergenic
1071747262 10:88436243-88436265 GTAAAAGTGTGATGAGACCCAGG + Intronic
1074269582 10:111940570-111940592 GCAAAAGTGTGAGCAAAACTAGG + Intergenic
1074430557 10:113390632-113390654 GGAACAGTGTGCCCAACACCTGG + Intergenic
1075852026 10:125597046-125597068 CAAAAAGAGTGACCCAAACCTGG + Intronic
1077264004 11:1640074-1640096 GTAGAACAATGACCAAAACCAGG - Intergenic
1078513456 11:12003909-12003931 CTCAAAGTGTGAATAAAACCTGG + Intronic
1079081226 11:17414892-17414914 CCAAAAGTGTGACCAAACCAAGG + Intronic
1083810015 11:65098854-65098876 GGAAAAGTGTGAGGATAACCAGG + Intronic
1084573495 11:69974400-69974422 GAGAACATGTGACCAAAACCAGG - Intergenic
1085342664 11:75743624-75743646 TTAAAAGTGTGATCAAGGCCGGG - Intergenic
1090599268 11:128353603-128353625 ATAAAAGTGTGACCAAGAGTAGG + Intergenic
1091019167 11:132083035-132083057 GTAATAGAGTGCCCATAACCTGG - Intronic
1091191126 11:133696107-133696129 GTAAAGGTCTGATCAACACCGGG - Intergenic
1092707941 12:11305031-11305053 GTAAAAGTGTGGCCATCAACTGG + Intergenic
1096357183 12:50951086-50951108 GTAAAAGTCTGACAAATAACAGG + Intergenic
1098497757 12:71156024-71156046 GAAAAAATGTAACCACAACCAGG - Intronic
1099293928 12:80806175-80806197 ATAAAAATGTACCCAAAACCGGG - Intronic
1100319061 12:93472934-93472956 CAAAAACTGTGACCAAAATCTGG + Intronic
1102647498 12:114413450-114413472 CTAAATGTGTGAGCAAAACCAGG - Intergenic
1106964392 13:35042932-35042954 GTAAAAGTGTCACTAAAAGGTGG + Intronic
1107025951 13:35801668-35801690 GTAAAACTGTGCACAAAACCAGG + Intronic
1108373104 13:49790630-49790652 GTAATGTTGTGACCAATACCAGG + Intronic
1109970633 13:69763637-69763659 GTGAGAGTGTGACCAAAACGGGG - Intronic
1112857575 13:103790170-103790192 ATTAAAGTCTGATCAAAACCTGG - Intergenic
1113741487 13:112715124-112715146 GTGAATGTGTGAGCAAAACGTGG - Intronic
1114544421 14:23488075-23488097 GTTAAAGTTTGCCCAAAGCCAGG + Intronic
1116901493 14:50366288-50366310 GTAAAGGTCTGACCAAACCAAGG + Intronic
1117923251 14:60747747-60747769 GTAAAATTGTTACCATAAGCTGG - Intronic
1119785159 14:77307579-77307601 GGAAATGTATGACCAATACCAGG - Intronic
1121144574 14:91573349-91573371 CTAAAAGAGTGACCAACACATGG - Intergenic
1129964593 15:79722827-79722849 GGAAAAGTATGAACAAATCCTGG + Intergenic
1136660375 16:31753584-31753606 GTAATAGGGTGACTAAAGCCAGG - Intronic
1139228653 16:65258678-65258700 GTAAAAGTATGATCAGAAGCTGG - Intergenic
1140886421 16:79247991-79248013 GTAAAATTCTGTCCAAAACTGGG - Intergenic
1140970360 16:80006578-80006600 GTAACAGTGTAGCCAAGACCCGG - Intergenic
1141906169 16:87028443-87028465 CTTAAAGGGTGACCACAACCTGG - Intergenic
1148319373 17:46737396-46737418 GTATAAGTCTGACCAAAATATGG - Intronic
1153394134 18:4598727-4598749 GAAAAAGTGTAAGCAAAACTGGG + Intergenic
1153630477 18:7064468-7064490 GTAAGAATGTGACCGAAATCAGG - Intronic
1155545229 18:26907652-26907674 GTAATAGTGTGAGCAAAATAGGG + Exonic
1157007450 18:43601482-43601504 ATAAAAACATGACCAAAACCAGG + Intergenic
1157789486 18:50518688-50518710 GTAAAGCTGAGACCAAAAGCTGG - Intergenic
1158297791 18:56018081-56018103 GGAAGAGTGTGACCTAAGCCTGG + Intergenic
1159204019 18:65226966-65226988 GGAAAAATATGACCAAAACCTGG + Intergenic
1163375155 19:16925532-16925554 GTAAAACTGTCACCAAAGCCAGG - Intronic
1163621466 19:18363347-18363369 GTAAGAGAGAGACCAAAACGGGG - Intronic
1164042127 19:21502636-21502658 GTCACAGTGTAACCAAAACTCGG - Intronic
1164897848 19:31892712-31892734 GTAAAAGTCAAACCAAAGCCTGG + Intergenic
930375960 2:50566856-50566878 GAGAAAGTGTGCCCAGAACCAGG - Intronic
940175196 2:150870768-150870790 ATAAAAGAGTGAGCAGAACCTGG + Intergenic
942233136 2:173878315-173878337 GTACAAGTATGAATAAAACCAGG - Intergenic
942613811 2:177769014-177769036 GTAAAACTGATGCCAAAACCGGG + Intronic
942873025 2:180758824-180758846 TTAAAAGTGTCAGCAAAAACAGG + Intergenic
942983700 2:182113492-182113514 GGAAAAGTCTGACCAACACGTGG + Intronic
944873503 2:203938051-203938073 GTACAAGGATGAGCAAAACCAGG + Intronic
946901469 2:224377104-224377126 TTAAAAGTGAAACCAAAATCTGG + Intergenic
947203531 2:227638701-227638723 ATAGAAGAGTGACCAAAAACAGG - Intergenic
947402906 2:229746517-229746539 GTAAGAGTGAGGCCAAAGCCAGG + Intergenic
948564717 2:238876734-238876756 GCCAAAGTGTGTCAAAAACCTGG - Intronic
1174363593 20:50043245-50043267 GAGAAAGTGTGGCCAAAACAGGG - Intergenic
1174698212 20:52581544-52581566 GTGAAAGTATGACTCAAACCTGG - Intergenic
1177642520 21:23861875-23861897 GGAAATGTGGGACTAAAACCAGG + Intergenic
1178989185 21:37337867-37337889 GTAAAATTTTGACAAAAACCTGG - Intergenic
1181024317 22:20119214-20119236 TTAAAAGTCAGGCCAAAACCTGG - Intronic
1184546841 22:45176174-45176196 GGAACTGTGTGAGCAAAACCAGG + Intronic
949863729 3:8530019-8530041 GAAAAACTGAGACTAAAACCCGG + Intronic
950281964 3:11715739-11715761 GCAAAAATGTGACCAGAAGCCGG - Intronic
951650134 3:24942146-24942168 GTAAAACTGGGACTGAAACCAGG + Intergenic
955638070 3:61052053-61052075 GTAAATGTGTGACCTAAATGAGG + Intronic
956600229 3:71013163-71013185 GTTAAAGTATGACTAAGACCTGG - Intronic
957269651 3:78012845-78012867 GCAAAATTGTTACCAAAACAAGG - Intergenic
958774310 3:98462922-98462944 GTAAATGTGTGCCCAAAACATGG + Intergenic
965137712 3:164794427-164794449 GAAACAGTGTGACCAGAAGCAGG - Intergenic
966197241 3:177325676-177325698 TTAAAACTGTGACCAATACGTGG - Intergenic
967418716 3:189250330-189250352 GTAAAAGTGGGACTAGAACCCGG - Intronic
970802877 4:19995493-19995515 ATAAAATTGTGGCTAAAACCTGG + Intergenic
972208512 4:36807502-36807524 GAAAAAGAGTAAACAAAACCTGG - Intergenic
972346405 4:38196132-38196154 GTAACAGTGTGAGCAGAACCAGG - Intergenic
975185481 4:71397259-71397281 GACAAAGAGTGAACAAAACCAGG + Intronic
976193727 4:82513517-82513539 GAAAATGTGTGACTAAAATCTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
982401298 4:154970903-154970925 GCAAAAGTGTCACCAAAATGAGG - Intergenic
982831479 4:160066522-160066544 GTAAAATTGAGACCAAAATAAGG - Intergenic
984237432 4:177177183-177177205 GTTAAATTGTTAACAAAACCTGG + Intergenic
991379967 5:66010497-66010519 GTAAAAGTATGATGAAAAACAGG - Intronic
993075344 5:83223550-83223572 TTCAAATGGTGACCAAAACCAGG - Intronic
993621090 5:90168575-90168597 GTAAAAGTGTGAAGGAAGCCAGG + Intergenic
993904535 5:93608114-93608136 GAAAAAGTGTGACGAAAACAAGG - Intergenic
995432555 5:112097642-112097664 CTCAAAGTATGACCAAAACTGGG + Intergenic
995610817 5:113908886-113908908 GAAAAGTTGTGACAAAAACCTGG - Intergenic
996496382 5:124161832-124161854 GTGAAAGTGAGATCCAAACCTGG - Intergenic
999197086 5:149789707-149789729 GTAACAGTGAGACCAGAGCCAGG - Intronic
999735952 5:154513236-154513258 GTAAAGGTGTGGCTAATACCTGG - Intergenic
1000148287 5:158474342-158474364 TAAAAACTGTGACCAAAACTGGG + Intergenic
1001157209 5:169283110-169283132 GTAAAACTGTGATTCAAACCTGG + Intronic
1004765979 6:18727402-18727424 GTGAGAGCGTGACCAAAACTTGG - Intergenic
1004843183 6:19610645-19610667 CTAAGAGAGTGACCAAAACAAGG - Intergenic
1006479009 6:34276854-34276876 GTAAAACAGTGACCACCACCTGG + Intergenic
1009778225 6:68233907-68233929 GTAAGCATGTGACCAAAACCTGG + Intergenic
1010655200 6:78503503-78503525 GTAAAAGTGAATCTAAAACCTGG - Intergenic
1010799177 6:80154014-80154036 GGTAAAGTGTGACCAAAGGCAGG - Intronic
1013205458 6:107940969-107940991 GTAAAAGGTTAACCAAAAACAGG + Intronic
1013441388 6:110173877-110173899 GTAAAAAAGTGTCTAAAACCAGG + Intronic
1013733605 6:113200461-113200483 GTAAAATTGTGAGCAAAAGCAGG - Intergenic
1016190964 6:141263538-141263560 GTAAAAGGGTGACCAAGAAAAGG + Intergenic
1018230192 6:161667867-161667889 ATAAAAGAGTGAGAAAAACCTGG + Intronic
1022249933 7:28597355-28597377 GAATAAGTGAGACCAAGACCAGG - Intronic
1023570028 7:41562245-41562267 ATAGAAGGGTGACCAAAATCAGG + Intergenic
1024997293 7:55281827-55281849 GTGAGAGTGTGACTAAAACTTGG + Intergenic
1029016387 7:97319054-97319076 GTGAGAGTGTGACCAAAACTAGG + Intergenic
1030675721 7:112383755-112383777 GTTAAAATGTGACCAAAAGAGGG - Intergenic
1032417555 7:131748359-131748381 GTAAAAGTGTAAACAAAGTCAGG - Intergenic
1033425853 7:141243573-141243595 GTAGAAGTGTGACCGTTACCAGG + Intronic
1035818555 8:2566589-2566611 GAAAAAGTGAGACACAAACCTGG - Intergenic
1036588391 8:10146366-10146388 GTGAAACTGTGAGCAAAAGCAGG + Intronic
1043137383 8:76545276-76545298 GCGAGAGTGTGACCAAAACTTGG - Intergenic
1045911794 8:107418696-107418718 GTAAAAGGGTGATAAAAATCTGG + Intronic
1046623115 8:116548639-116548661 GTAAAAATATGACCAAAAATAGG + Intergenic
1048341651 8:133544445-133544467 GTAAACCTATGACCATAACCAGG + Intronic
1048707602 8:137171063-137171085 CTAAAAGTGGGACATAAACCAGG + Intergenic
1049044073 8:140135805-140135827 TTAAAAGAGAGAACAAAACCAGG + Intronic
1050649254 9:7757475-7757497 GAAGAAGTGTGGCCAGAACCTGG - Intergenic
1055312731 9:75000564-75000586 CTAAAAGTTTTACCAAAACAAGG + Intronic
1059005841 9:110401125-110401147 GCAAAAGTAGGACCAAACCCTGG - Intronic
1186641725 X:11462813-11462835 TAAAAAGTGTGAGCAAAAACTGG + Intronic
1191088396 X:56594197-56594219 GTCATAGTGACACCAAAACCTGG - Intergenic
1192983539 X:76372066-76372088 GTGAGAGTGTGACCAAAAAAGGG - Intergenic
1193046418 X:77059534-77059556 GTAAAAGTGGTAACATAACCTGG - Intergenic
1196323539 X:114372574-114372596 GAAACAATGTTACCAAAACCAGG - Intergenic
1196928190 X:120655026-120655048 GTAATAGTGTTGCCAAAAGCAGG - Intergenic
1196973413 X:121133603-121133625 GCAAGAGTGTGACCAAAACTTGG + Intergenic
1200462425 Y:3473532-3473554 GGAAGAGTGTGACCAAAATGTGG - Intergenic
1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG + Intronic
1201765008 Y:17567637-17567659 GAAAGAGTGTGACAAAAACTTGG - Intergenic
1201836544 Y:18338352-18338374 GAAAGAGTGTGACAAAAACTTGG + Intergenic