ID: 1200762539

View in Genome Browser
Species Human (GRCh38)
Location Y:7053477-7053499
Sequence GTGCTAAGTATGCTAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200762539_1200762546 26 Left 1200762539 Y:7053477-7053499 CCACCTTTTAGCATACTTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1200762546 Y:7053526-7053548 ACTTTAATGATAAGAACTGGAGG 0: 2
1: 10
2: 7
3: 32
4: 242
1200762539_1200762545 23 Left 1200762539 Y:7053477-7053499 CCACCTTTTAGCATACTTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1200762545 Y:7053523-7053545 TGAACTTTAATGATAAGAACTGG 0: 1
1: 11
2: 10
3: 25
4: 222
1200762539_1200762547 30 Left 1200762539 Y:7053477-7053499 CCACCTTTTAGCATACTTAGCAC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1200762547 Y:7053530-7053552 TAATGATAAGAACTGGAGGTTGG 0: 2
1: 0
2: 13
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200762539 Original CRISPR GTGCTAAGTATGCTAAAAGG TGG (reversed) Intronic
904927636 1:34061167-34061189 CTGCTAAATATCCTACAAGGTGG + Intronic
906462706 1:46048501-46048523 GTGATAAGAATGCTTAGAGGAGG - Intronic
907587826 1:55637149-55637171 GTGGTAATTAAGCTAAGAGGAGG + Intergenic
908262186 1:62347861-62347883 GTGCTGAGTGTGCTCAAGGGAGG - Intergenic
911220541 1:95240825-95240847 ATGCTAAGTATGAAAGAAGGAGG + Intronic
917426576 1:174920658-174920680 GTGGTAATTAAGGTAAAAGGAGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921124483 1:212164931-212164953 GAGCTAAGTGAGCGAAAAGGAGG - Intergenic
923413847 1:233735425-233735447 GTGCTTTGAATGCCAAAAGGGGG + Intergenic
924769382 1:247065594-247065616 GTGCAGAGTATGTTTAAAGGGGG + Intronic
1063825220 10:9889658-9889680 GTGCTATGTATGCTAAAATACGG - Intergenic
1065767654 10:29046309-29046331 GTGATAACTTTGATAAAAGGAGG - Intergenic
1067190238 10:44062423-44062445 GTGCTAAGGAGGCTGAAGGGAGG + Intergenic
1067820950 10:49529636-49529658 GTGGAAAGTATAATAAAAGGAGG + Intronic
1070963466 10:80515452-80515474 GAGGTAATTATGCTAAAATGAGG - Intronic
1073191257 10:101651869-101651891 GTGCTAAGTGAGATGAAAGGGGG + Intronic
1086247149 11:84767139-84767161 GTGCTAAATATGTTAAAATATGG - Intronic
1087382612 11:97425872-97425894 GTGCTAAGTAAGCTAACAGAAGG - Intergenic
1092783065 12:12005068-12005090 GTGCTAGGTTTGCCTAAAGGAGG - Intergenic
1096438525 12:51617527-51617549 ATTCTAAGTATGCTCAAAGAAGG - Intronic
1098477185 12:70919463-70919485 GTGCTATGTATGCAAAAAGCAGG + Intronic
1109656901 13:65404265-65404287 ATGCTACGTCTGCTAAAAGATGG - Intergenic
1109894378 13:68664854-68664876 GAGCTAATTAAGCTAAAATGGGG - Intergenic
1115615999 14:35095537-35095559 GAGATAAGAATGCCAAAAGGAGG + Intronic
1118594237 14:67423592-67423614 GTGGTAAGTCTGAGAAAAGGTGG + Intergenic
1119218299 14:72885979-72886001 GTGCTAAGAATGCAGAATGGTGG + Intronic
1124208625 15:27744102-27744124 GGGCTAAGGATGCTAAATCGAGG - Intergenic
1126953192 15:53905901-53905923 CTGCTTAGTATGATAAAAGTAGG - Intergenic
1131075770 15:89494068-89494090 GGGGTAAGGATGCTAACAGGGGG - Intronic
1140863052 16:79036015-79036037 GTGCTGAGTATGCTGGAAGGAGG - Intronic
1144997017 17:19277055-19277077 GTGCAAACTATGCGAAAAAGAGG + Intronic
1153982850 18:10326636-10326658 GAGGTAATTATGTTAAAAGGAGG - Intergenic
1158347852 18:56533854-56533876 GTGATAATTAAGTTAAAAGGAGG - Intergenic
1160964491 19:1740548-1740570 GTTCTCAGTTTGCTAAATGGAGG + Intergenic
925335671 2:3097686-3097708 GTGCTAGGAATGAAAAAAGGGGG + Intergenic
929223044 2:39485100-39485122 ATGTTAAGTATCCTAAAAGCAGG + Intergenic
930722588 2:54652009-54652031 ATGCTAAGTGGGGTAAAAGGCGG - Intronic
935218688 2:100994045-100994067 GTGCCAAGTATGTCAAAAGCAGG + Intronic
941345359 2:164361833-164361855 GTCCTAATTACCCTAAAAGGTGG + Intergenic
944150147 2:196548943-196548965 GAGGTAATTAAGCTAAAAGGAGG - Intronic
946625708 2:221610440-221610462 GTGGTAATTAAGTTAAAAGGAGG - Intergenic
947109912 2:226707677-226707699 GTGCTAGGGATGCTATATGGAGG - Intergenic
1171471424 20:25375016-25375038 GAGGTAATTATGCTAAAATGAGG + Intronic
1174587821 20:51622486-51622508 GTGATAAATATCCTAAAAGAAGG + Intronic
1178644023 21:34369806-34369828 GTCCCAAGTATCCTAAAGGGAGG - Intronic
1182390183 22:29987401-29987423 GTGTTTAGTATGCAAAGAGGAGG - Intronic
1182538055 22:31020660-31020682 GAGATTAGTATGCTAGAAGGCGG - Intergenic
1182780887 22:32866657-32866679 GTGATAACTGTGATAAAAGGTGG + Intronic
1182895050 22:33852548-33852570 GTGCTAAGTACGATAAAGGCTGG + Intronic
951087848 3:18535591-18535613 GTGCTAAGTATGATATAACAAGG + Intergenic
954446711 3:50550722-50550744 GTGCTGGGTTTGATAAAAGGTGG - Intergenic
957135493 3:76282871-76282893 GTGCTAAGGCTGACAAAAGGTGG - Intronic
962537483 3:136342927-136342949 CTGCCAAGTATCCTAGAAGGTGG - Intronic
963731293 3:148975730-148975752 GTGCTATCTTTGATAAAAGGGGG - Intergenic
964096877 3:152942141-152942163 GTGCTATATATGCAATAAGGAGG - Intergenic
966035135 3:175402826-175402848 GTGCTAAGTCTGGTCAAAGAAGG - Intronic
966246626 3:177815700-177815722 GAGCTAAGTAGGTTAAAATGAGG - Intergenic
967187850 3:186960618-186960640 GTGCTGAGTATGGTGATAGGAGG + Intronic
969794516 4:9516427-9516449 GTGCTAAGAAAGCTCAATGGTGG + Intergenic
973960691 4:56107081-56107103 CTACTCAGTAGGCTAAAAGGGGG - Intergenic
981607973 4:146560211-146560233 GTGATTAGTATTCTAAAAGCTGG + Intergenic
990333468 5:54749793-54749815 GTGGTAATTATGTTAAAATGAGG + Intergenic
990575054 5:57116123-57116145 GTGGTAATTATGTTAAAATGAGG - Intergenic
993983642 5:94571127-94571149 GTTCTAAATTTGCTAAAAGAAGG + Intronic
996263254 5:121500768-121500790 GAGGTAAGTATGTTAAAATGAGG + Intergenic
996644884 5:125801456-125801478 GTGATAAGTATGGCTAAAGGTGG - Intergenic
997286209 5:132680553-132680575 GTGGTAAATAGGCTGAAAGGGGG + Intronic
1002941721 6:1722739-1722761 GTGGTAATTATGCTCAAATGTGG - Intronic
1012610090 6:101207146-101207168 GTGCAAAATATGCTATAAAGTGG + Intergenic
1014599269 6:123389050-123389072 GGCATAAGTTTGCTAAAAGGAGG - Intronic
1016950854 6:149578134-149578156 GTGCTTATTATGTTAAAACGTGG + Intronic
1022702558 7:32775526-32775548 CTGCTAAGGATGCTAAGAGGGGG - Intergenic
1023296199 7:38717284-38717306 GAGGTAAGTATGGTAAAATGAGG - Intergenic
1023974235 7:45015974-45015996 GTGCTAAAAATGATAAAAGGAGG - Intronic
1024360515 7:48462868-48462890 GTGCTAGGAGTTCTAAAAGGAGG - Intronic
1034645585 7:152643717-152643739 CTGCTAAGTGTTCTTAAAGGAGG - Intergenic
1038608654 8:29037806-29037828 GTTCTAAGTATGTTTAAAGCTGG + Intronic
1041315406 8:56556779-56556801 ATGCTAAGTATGCAAATAGCAGG + Intergenic
1044606896 8:94055824-94055846 GTGCTCAGTGTGCTAACAGCAGG + Intergenic
1046745721 8:117873956-117873978 GTGGTAAATATGCTACAAAGTGG + Intronic
1046837143 8:118814520-118814542 ATGGTAAGTATGCAAAAGGGGGG + Intergenic
1050004825 9:1119091-1119113 GTGCTAGGGATGCTGAAAGAGGG + Intergenic
1050032970 9:1405716-1405738 GTGCTAAGTCTGCTCCCAGGTGG + Intergenic
1051650450 9:19318793-19318815 GAGGTAATTATGCTAAAATGAGG - Intronic
1055249992 9:74292565-74292587 GTTCTAAGTATTGTAATAGGAGG - Intergenic
1059986571 9:119825826-119825848 GTTTTAAGTTAGCTAAAAGGAGG + Intergenic
1062408009 9:136406842-136406864 TTGCTAAGTATTCCAAGAGGAGG - Intronic
1186227238 X:7412734-7412756 GACCTACGTATGCCAAAAGGTGG - Intergenic
1187752018 X:22477287-22477309 GTGCGACTTATGCTATAAGGAGG + Intergenic
1188983646 X:36750592-36750614 ATGCTAAGTACTCTAACAGGAGG + Intergenic
1200762539 Y:7053477-7053499 GTGCTAAGTATGCTAAAAGGTGG - Intronic
1201665740 Y:16452302-16452324 GAGTTAAGTATGCTCATAGGAGG - Intergenic
1201694091 Y:16805611-16805633 GTGCTAACTATTCTCAAAGTAGG + Intergenic