ID: 1200763620

View in Genome Browser
Species Human (GRCh38)
Location Y:7062283-7062305
Sequence TAGGCTACGCCCTTTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 11, 2: 6, 3: 10, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200763620_1200763622 -7 Left 1200763620 Y:7062283-7062305 CCTCCAACAAAGGGCGTAGCCTA 0: 1
1: 11
2: 6
3: 10
4: 46
Right 1200763622 Y:7062299-7062321 TAGCCTACTTCTTGAGACACTGG 0: 1
1: 1
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200763620 Original CRISPR TAGGCTACGCCCTTTGTTGG AGG (reversed) Intronic
901947054 1:12712490-12712512 TAGGCTATGCTCTTTGCTGGAGG - Intergenic
911157139 1:94647840-94647862 TAGGGTATGCCCTTTCTTGCAGG + Intergenic
913231581 1:116744710-116744732 TAGACTATGCCCTGTGCTGGGGG + Intergenic
914986495 1:152461646-152461668 GAGGCTAAGCCCTTTGTGGGAGG - Intergenic
917312320 1:173690496-173690518 TAGGCTATGCCCTTTGTTGGAGG - Intergenic
918703295 1:187632033-187632055 TAGGCTATGCCCTCTGTTGACGG + Intergenic
1062957127 10:1547736-1547758 AAGTCTACGCACTGTGTTGGGGG + Intronic
1064117323 10:12589667-12589689 GAAGCTACTCCCTGTGTTGGAGG - Intronic
1066653471 10:37680314-37680336 CAGGCCACGCCCTTCGTAGGAGG - Intergenic
1071283620 10:84124910-84124932 TAGGCTATGCTCTTTGTTGGAGG - Intergenic
1072024181 10:91437527-91437549 TAGACTCCATCCTTTGTTGGGGG + Intronic
1077702533 11:4455458-4455480 TAGACTATGCCTTGTGTTGGTGG + Intergenic
1081042207 11:38225993-38226015 TAGATTATGCCCTGTGTTGGTGG - Intergenic
1081796439 11:45823756-45823778 TAGGAAAAGCCCTTTGTTTGGGG + Intergenic
1082946836 11:58770481-58770503 TAGGAAAAGCCCTTTGTTTGGGG + Intergenic
1088951036 11:114570124-114570146 TAGGAAAAGCCCTTTGTTTGGGG + Intergenic
1092586989 12:9910021-9910043 TAGAGTATGCTCTTTGTTGGAGG - Intronic
1102605698 12:114065776-114065798 TAGGCTAAGCCCTTTGTTGGAGG + Intergenic
1108114465 13:47111507-47111529 TAGGAAAAGCCCTTTGTTTGGGG - Intergenic
1113415946 13:110128730-110128752 TAGGCTGCCCCCTTTTTTGGAGG - Intergenic
1113524831 13:110966685-110966707 TAGGCTATGCCCTTTGTTGGAGG + Intergenic
1115828189 14:37300974-37300996 TGGGGTGTGCCCTTTGTTGGGGG + Intronic
1133956240 16:10446489-10446511 TAGGTTATGCCCTATGTTGGTGG - Intronic
1134212381 16:12288585-12288607 CAGGCTAAGCCCTTCTTTGGGGG + Intronic
1134302464 16:13003957-13003979 TAGGCTAAGCTATGTGTTGGGGG + Intronic
1155209215 18:23586520-23586542 TCGGCTCCGCCCTTTCTGGGAGG + Exonic
1160702758 19:516264-516286 TAGGAAAAGCCCTTTGTTCGAGG - Intronic
1162268543 19:9595659-9595681 TACGCTATGCCCTTTGTTGGAGG - Intergenic
1166070151 19:40382349-40382371 TAGTCCACGCACTTTGGTGGGGG - Intronic
1166157926 19:40928895-40928917 CAGGCAAAGCCCTTTGTTCGGGG - Intergenic
1167120305 19:47512805-47512827 TAGGCCACGCCCCTTGTTTGAGG - Intronic
927978136 2:27356097-27356119 GAGGCAACTCACTTTGTTGGAGG - Exonic
932781241 2:74560033-74560055 AAGGCTACTCCCTTGGATGGGGG + Intronic
933390150 2:81657272-81657294 TAGGCTATGCCCTTTGTTGGAGG - Intergenic
935047852 2:99498110-99498132 TAGGCTATGCCCTTTGTTGGAGG + Intergenic
940352153 2:152702608-152702630 TGGACTATGCTCTTTGTTGGAGG + Intronic
947556659 2:231099289-231099311 TAGGCTATGCCCTTTATTGGAGG - Intronic
1168823488 20:793096-793118 TAGGCTATGCCCTTTGTTGGAGG + Intergenic
1173277249 20:41595895-41595917 TAGACTATGCCCTGTGCTGGCGG + Intronic
1178287532 21:31337929-31337951 TTGGCTCCGCTCTCTGTTGGAGG + Intronic
1184065157 22:42114422-42114444 TGGCCTATGCTCTTTGTTGGAGG - Intergenic
950488771 3:13289548-13289570 TGGGCTAGGCCCTTGGCTGGAGG - Intergenic
950602407 3:14046142-14046164 CAGACTATGCCCTGTGTTGGCGG - Intronic
952614356 3:35251737-35251759 TAGACTAAGACCTTTGTTGATGG - Intergenic
954883550 3:53852470-53852492 AAAGCTATGCCCTTTGTTTGGGG + Intronic
962048702 3:131789713-131789735 TAGGCTAAGTCCTGTGTTAGGGG + Intronic
978313821 4:107414515-107414537 TAGGCTATGCCCTTTGTTGGAGG + Intergenic
981070959 4:140538165-140538187 TAGACTAGTCCCTTTGTTTGAGG + Intronic
983740205 4:171121526-171121548 GAGGCTTCGCACTTTGATGGGGG + Intergenic
986209417 5:5656585-5656607 TAGCCAAAGCCCTTTGTTGCAGG + Intergenic
988936610 5:36089838-36089860 TAGGCTAAGCCCTAAGTTTGGGG - Intergenic
989615732 5:43335225-43335247 TAGGCTATGCCCTTTGTTGGAGG - Intergenic
993873027 5:93273947-93273969 TAGACTCTGCCTTTTGTTGGGGG + Intergenic
999784569 5:154879755-154879777 TAGACTATGCCCTGTGTTGGTGG + Intergenic
1004454378 6:15778170-15778192 TTGGCTCTGCCCTTGGTTGGTGG - Intergenic
1009495039 6:64335545-64335567 TAGGAAAAGCCCTTTGTTTGGGG + Intronic
1011212223 6:84967088-84967110 TAGATTATGCCCTATGTTGGTGG - Intergenic
1013422845 6:109981731-109981753 TAGTCTACTCCCTTGGTTAGTGG + Intergenic
1014197323 6:118575446-118575468 TAAACTATGCCCTGTGTTGGCGG + Intronic
1015812053 6:137170617-137170639 TAGGAAAAGCCCTTTGTTTGGGG + Intronic
1015873572 6:137800727-137800749 TTGGCTACAGCCCTTGTTGGGGG + Intergenic
1020744819 7:12068032-12068054 TAGACTATGCTCTTTGTTGGAGG + Intergenic
1023798247 7:43811511-43811533 TAGGCTATGCCCTTTGCTAGAGG + Intergenic
1023798740 7:43814818-43814840 TAGGCTATGCCCTTCGTTGGAGG + Intergenic
1028333611 7:89625460-89625482 TAGGCTATGCCCTTTGTTGGAGG + Intergenic
1031417408 7:121510054-121510076 TAGACTATGCCCTGTGTTGGTGG - Intergenic
1033098202 7:138448971-138448993 TAGGCTATGCCCTTTGTTGGAGG - Intergenic
1042088286 8:65132022-65132044 TAGGCTATACCCTTTGTTGGAGG - Intergenic
1042554955 8:70026559-70026581 TATGCTACAGCCTCTGTTGGAGG + Intergenic
1056414915 9:86366695-86366717 TAGGCTATGCCCTTTGTTGGAGG - Intergenic
1189834378 X:45005441-45005463 TAGGCTATGCCCTCTGTTGGAGG - Intronic
1193325352 X:80173342-80173364 TAGGAAAAGCCCTTTGTTCGGGG - Intergenic
1200763620 Y:7062283-7062305 TAGGCTACGCCCTTTGTTGGAGG - Intronic
1202592477 Y:26500924-26500946 GAGGCTGCTCCCTTTGATGGTGG - Intergenic