ID: 1200768926

View in Genome Browser
Species Human (GRCh38)
Location Y:7105786-7105808
Sequence CACTGCTAACATGAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200768921_1200768926 -8 Left 1200768921 Y:7105771-7105793 CCTATGTGGATTCACCACTGCTA No data
Right 1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200768926 Original CRISPR CACTGCTAACATGAGGAGGT GGG Intergenic
No off target data available for this crispr