ID: 1200779485

View in Genome Browser
Species Human (GRCh38)
Location Y:7201504-7201526
Sequence GCACCCCTACTAAAAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200779482_1200779485 -6 Left 1200779482 Y:7201487-7201509 CCTTCTCCGAGTCAGGTGCACCC No data
Right 1200779485 Y:7201504-7201526 GCACCCCTACTAAAAAAAGTGGG No data
1200779479_1200779485 3 Left 1200779479 Y:7201478-7201500 CCCATGTCACCTTCTCCGAGTCA No data
Right 1200779485 Y:7201504-7201526 GCACCCCTACTAAAAAAAGTGGG No data
1200779480_1200779485 2 Left 1200779480 Y:7201479-7201501 CCATGTCACCTTCTCCGAGTCAG No data
Right 1200779485 Y:7201504-7201526 GCACCCCTACTAAAAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200779485 Original CRISPR GCACCCCTACTAAAAAAAGT GGG Intergenic