ID: 1200782779

View in Genome Browser
Species Human (GRCh38)
Location Y:7231908-7231930
Sequence CACCCAAGTCTGCTGTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200782779_1200782782 -9 Left 1200782779 Y:7231908-7231930 CCATTCAACAGCAGACTTGGGTG No data
Right 1200782782 Y:7231922-7231944 ACTTGGGTGGCAATATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200782779 Original CRISPR CACCCAAGTCTGCTGTTGAA TGG (reversed) Intergenic
No off target data available for this crispr