ID: 1200784561

View in Genome Browser
Species Human (GRCh38)
Location Y:7248952-7248974
Sequence TGGTCTTTTACCCATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200784561_1200784565 3 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data
1200784561_1200784566 4 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784566 Y:7248979-7249001 TGGCACAAACAATCCCATGTGGG No data
1200784561_1200784569 19 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784569 Y:7248994-7249016 CATGTGGGAAGACCGCTCCAAGG No data
1200784561_1200784571 21 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784571 Y:7248996-7249018 TGTGGGAAGACCGCTCCAAGGGG No data
1200784561_1200784570 20 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784570 Y:7248995-7249017 ATGTGGGAAGACCGCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200784561 Original CRISPR TGGTCTTTTACCCATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr