ID: 1200784564

View in Genome Browser
Species Human (GRCh38)
Location Y:7248972-7248994
Sequence GGGATTGTTTGTGCCATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200784564_1200784573 15 Left 1200784564 Y:7248972-7248994 CCAAACATGGCACAAACAATCCC No data
Right 1200784573 Y:7249010-7249032 TCCAAGGGGCAGAAGTCACCAGG No data
1200784564_1200784571 1 Left 1200784564 Y:7248972-7248994 CCAAACATGGCACAAACAATCCC No data
Right 1200784571 Y:7248996-7249018 TGTGGGAAGACCGCTCCAAGGGG No data
1200784564_1200784570 0 Left 1200784564 Y:7248972-7248994 CCAAACATGGCACAAACAATCCC No data
Right 1200784570 Y:7248995-7249017 ATGTGGGAAGACCGCTCCAAGGG No data
1200784564_1200784569 -1 Left 1200784564 Y:7248972-7248994 CCAAACATGGCACAAACAATCCC No data
Right 1200784569 Y:7248994-7249016 CATGTGGGAAGACCGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200784564 Original CRISPR GGGATTGTTTGTGCCATGTT TGG (reversed) Intergenic
No off target data available for this crispr