ID: 1200784565

View in Genome Browser
Species Human (GRCh38)
Location Y:7248978-7249000
Sequence ATGGCACAAACAATCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200784556_1200784565 30 Left 1200784556 Y:7248925-7248947 CCCTTTGACCTTGTACTCAAAGT No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data
1200784561_1200784565 3 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data
1200784558_1200784565 22 Left 1200784558 Y:7248933-7248955 CCTTGTACTCAAAGTATCTCCAA No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data
1200784557_1200784565 29 Left 1200784557 Y:7248926-7248948 CCTTTGACCTTGTACTCAAAGTA No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data
1200784562_1200784565 -1 Left 1200784562 Y:7248956-7248978 CCACATGGGTAAAAGACCAAACA No data
Right 1200784565 Y:7248978-7249000 ATGGCACAAACAATCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200784565 Original CRISPR ATGGCACAAACAATCCCATG TGG Intergenic
No off target data available for this crispr