ID: 1200784571

View in Genome Browser
Species Human (GRCh38)
Location Y:7248996-7249018
Sequence TGTGGGAAGACCGCTCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200784564_1200784571 1 Left 1200784564 Y:7248972-7248994 CCAAACATGGCACAAACAATCCC No data
Right 1200784571 Y:7248996-7249018 TGTGGGAAGACCGCTCCAAGGGG No data
1200784561_1200784571 21 Left 1200784561 Y:7248952-7248974 CCAACCACATGGGTAAAAGACCA No data
Right 1200784571 Y:7248996-7249018 TGTGGGAAGACCGCTCCAAGGGG No data
1200784562_1200784571 17 Left 1200784562 Y:7248956-7248978 CCACATGGGTAAAAGACCAAACA No data
Right 1200784571 Y:7248996-7249018 TGTGGGAAGACCGCTCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200784571 Original CRISPR TGTGGGAAGACCGCTCCAAG GGG Intergenic
No off target data available for this crispr