ID: 1200784649

View in Genome Browser
Species Human (GRCh38)
Location Y:7249436-7249458
Sequence GCAGTATTTGCATATCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200784645_1200784649 10 Left 1200784645 Y:7249403-7249425 CCAAGGATGCTCAAGCCCCTTGT No data
Right 1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG No data
1200784647_1200784649 -6 Left 1200784647 Y:7249419-7249441 CCCTTGTAGCAAACGATGCAGTA No data
Right 1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG No data
1200784646_1200784649 -5 Left 1200784646 Y:7249418-7249440 CCCCTTGTAGCAAACGATGCAGT No data
Right 1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG No data
1200784644_1200784649 26 Left 1200784644 Y:7249387-7249409 CCACTGATATCAAAATCCAAGGA No data
Right 1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG No data
1200784648_1200784649 -7 Left 1200784648 Y:7249420-7249442 CCTTGTAGCAAACGATGCAGTAT No data
Right 1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200784649 Original CRISPR GCAGTATTTGCATATCACCC AGG Intergenic
No off target data available for this crispr