ID: 1200787895

View in Genome Browser
Species Human (GRCh38)
Location Y:7274940-7274962
Sequence CAGGAGCAGCTGGGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200787880_1200787895 27 Left 1200787880 Y:7274890-7274912 CCCAGCGGCAGGGTCCTTGGCGG No data
Right 1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG No data
1200787882_1200787895 26 Left 1200787882 Y:7274891-7274913 CCAGCGGCAGGGTCCTTGGCGGG No data
Right 1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG No data
1200787885_1200787895 13 Left 1200787885 Y:7274904-7274926 CCTTGGCGGGGAATGTACAGATT No data
Right 1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200787895 Original CRISPR CAGGAGCAGCTGGGCTCCGG GGG Intergenic
No off target data available for this crispr