ID: 1200795509

View in Genome Browser
Species Human (GRCh38)
Location Y:7337819-7337841
Sequence CTAAGGTTGTATAAGTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200795509_1200795512 1 Left 1200795509 Y:7337819-7337841 CCTGGATACTTATACAACCTTAG No data
Right 1200795512 Y:7337843-7337865 TGTGTGTCCTTACCCTAACATGG 0: 2
1: 0
2: 0
3: 13
4: 95
1200795509_1200795517 30 Left 1200795509 Y:7337819-7337841 CCTGGATACTTATACAACCTTAG No data
Right 1200795517 Y:7337872-7337894 AAAGAGCCTCATCTTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200795509 Original CRISPR CTAAGGTTGTATAAGTATCC AGG (reversed) Intergenic
No off target data available for this crispr