ID: 1200796588

View in Genome Browser
Species Human (GRCh38)
Location Y:7346437-7346459
Sequence GTGCAGACACGGGCTGCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200796588_1200796595 22 Left 1200796588 Y:7346437-7346459 CCCTTCGCAGCCCGTGTCTGCAC No data
Right 1200796595 Y:7346482-7346504 GCTGGATTCCCACTCTTAGCAGG 0: 2
1: 0
2: 1
3: 7
4: 76
1200796588_1200796594 4 Left 1200796588 Y:7346437-7346459 CCCTTCGCAGCCCGTGTCTGCAC No data
Right 1200796594 Y:7346464-7346486 CCTATCGCAGCTCGATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200796588 Original CRISPR GTGCAGACACGGGCTGCGAA GGG (reversed) Intergenic
No off target data available for this crispr