ID: 1200797770

View in Genome Browser
Species Human (GRCh38)
Location Y:7357356-7357378
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200797770_1200797773 -7 Left 1200797770 Y:7357356-7357378 CCAAATCCCATCTGAGTTGAGTG 0: 2
1: 0
2: 1
3: 7
4: 166
Right 1200797773 Y:7357372-7357394 TTGAGTGACATTATATCAAGTGG No data
1200797770_1200797774 -3 Left 1200797770 Y:7357356-7357378 CCAAATCCCATCTGAGTTGAGTG 0: 2
1: 0
2: 1
3: 7
4: 166
Right 1200797774 Y:7357376-7357398 GTGACATTATATCAAGTGGATGG No data
1200797770_1200797776 28 Left 1200797770 Y:7357356-7357378 CCAAATCCCATCTGAGTTGAGTG 0: 2
1: 0
2: 1
3: 7
4: 166
Right 1200797776 Y:7357407-7357429 TTTTATGATCGAGTTTGGCCAGG 0: 2
1: 0
2: 1
3: 1
4: 72
1200797770_1200797775 23 Left 1200797770 Y:7357356-7357378 CCAAATCCCATCTGAGTTGAGTG 0: 2
1: 0
2: 1
3: 7
4: 166
Right 1200797775 Y:7357402-7357424 AGCACTTTTATGATCGAGTTTGG 0: 2
1: 0
2: 1
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200797770 Original CRISPR CACTCAACTCAGATGGGATT TGG (reversed) Intergenic
904620730 1:31773510-31773532 CCCTCTACTCTGATGGGCTTTGG + Intergenic
906241312 1:44243900-44243922 CTCTGCACTCAGATGGGCTTGGG + Intronic
906264189 1:44416576-44416598 CACTCAGCCCAGATTGGAGTTGG + Intronic
907182667 1:52584505-52584527 CACACCAGTCAGATTGGATTAGG - Intergenic
908052897 1:60251830-60251852 GACACAAGTCAGATTGGATTAGG + Intergenic
910268494 1:85367129-85367151 AACTCAACTCAGATTGGTTTGGG - Intronic
910289873 1:85589324-85589346 GACTCAACACAGATGGTACTAGG + Intergenic
911372862 1:97014960-97014982 GACGCAAGTCAGATTGGATTAGG + Intergenic
915758214 1:158284116-158284138 CACTCATGTCAGATGGGTATGGG + Intergenic
916900683 1:169219166-169219188 CACTCAACACAGACTGGGTTGGG + Intronic
918090615 1:181290996-181291018 CTCTCCACTCAGAGGGCATTGGG - Intergenic
921045546 1:211474672-211474694 CTCCCAACTCAGCTAGGATTTGG - Intergenic
921167684 1:212518719-212518741 CACCGCACTCAGATGCGATTAGG - Intergenic
921555463 1:216593447-216593469 CACTTAAAACAGATGGGGTTGGG - Intronic
922135483 1:222821209-222821231 CAATTAATTCAGATGGGGTTGGG + Intergenic
922478210 1:225921470-225921492 CACTGAACTGAGGTGGGAGTTGG - Intronic
922594663 1:226804450-226804472 CACTCACCTCTGATGGGCATGGG - Intergenic
922707281 1:227796045-227796067 GACTCAGCTCTGCTGGGATTTGG + Intergenic
923999636 1:239536094-239536116 CTCTGAATTCAGATGGAATTTGG - Intronic
924547310 1:245041743-245041765 GACACAAGTCAGATTGGATTAGG - Intronic
1062849591 10:733357-733379 AACTGGTCTCAGATGGGATTGGG - Intergenic
1067203508 10:44194830-44194852 GACTCCAGTCATATGGGATTAGG + Intergenic
1067291676 10:44948156-44948178 CACTTGACTCTGCTGGGATTTGG + Intergenic
1067358446 10:45553773-45553795 CATTCACCTAAGACGGGATTAGG + Intronic
1067942986 10:50671540-50671562 CACACAACTGAGATAGGATAGGG + Intergenic
1070098312 10:73360138-73360160 CATCCAATTCAGATGAGATTGGG - Intergenic
1070864228 10:79696501-79696523 CACACAACTGAGATAGGATAGGG + Intergenic
1070965206 10:80526052-80526074 CCCTCAGCTGAGATGGGAATAGG - Exonic
1071275247 10:84048346-84048368 CACTCAACTCAGTAGCCATTTGG + Intergenic
1071631127 10:87218727-87218749 CACACAACTGAGATAGGATAGGG + Intergenic
1076337720 10:129719646-129719668 GACACCAGTCAGATGGGATTAGG + Intronic
1083486932 11:62988955-62988977 CATTCAACTTAGATGGCATGTGG - Intergenic
1084509131 11:69592237-69592259 GACACAAGTCAGATTGGATTAGG - Intergenic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1095377298 12:41545673-41545695 CACTCAACTTTGGTAGGATTGGG + Intronic
1097276426 12:57816537-57816559 CACTGAACTTAGATTGGTTTAGG - Intronic
1100075402 12:90775107-90775129 AACTCAAAGCAGAGGGGATTTGG + Intergenic
1100694095 12:97072411-97072433 GACACAAGTCAGATTGGATTGGG + Intergenic
1100843920 12:98640700-98640722 CACTCAAGCCATATGGGTTTGGG + Intronic
1102057132 12:109905134-109905156 CACTCAACTCTGGAGGGGTTGGG + Intronic
1103160438 12:118724860-118724882 CACTCAATTCTGCTGGGATTTGG - Intergenic
1106477831 13:30113662-30113684 GACACCAGTCAGATGGGATTAGG - Intergenic
1107823308 13:44305555-44305577 TACTGAAGTTAGATGGGATTAGG - Intergenic
1111188568 13:84777391-84777413 CACTCAAGTCACATGGGGTAAGG - Intergenic
1112364534 13:98745513-98745535 CACTCTACTCACATTGGATGAGG - Intronic
1112367425 13:98767318-98767340 AACTCACCTGAGATGGGATCAGG + Intergenic
1121968183 14:98329828-98329850 GACACAAATCAGATTGGATTAGG + Intergenic
1122760552 14:104021880-104021902 CACTAAAGTCACATGGAATTTGG - Intronic
1126256820 15:46637024-46637046 CTGCCAACTCACATGGGATTTGG + Intergenic
1127441325 15:59011697-59011719 GACTCCAGTCAGATTGGATTAGG + Intronic
1127707170 15:61558769-61558791 CTCTCAAGCCAGATTGGATTTGG - Intergenic
1128375881 15:67075486-67075508 CTCTCAAGTCTGATGGGTTTGGG + Intronic
1133253788 16:4503332-4503354 CCCTCAACACAGACAGGATTTGG - Intronic
1135481611 16:22825462-22825484 CACACAAGTCAGATGAGAATAGG + Intronic
1138748558 16:59391856-59391878 CACTCTACCCAGATTTGATTTGG - Intergenic
1139860972 16:70021020-70021042 GCCTCAACTCATTTGGGATTAGG - Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1141994898 16:87630178-87630200 CACTCAGGTGAGAAGGGATTCGG - Intronic
1144099332 17:11930167-11930189 CATGCAACTCAGAAGGGAGTCGG + Intronic
1144440486 17:15276867-15276889 CCCTCAACTGAGATGGGGTGGGG + Intergenic
1146089823 17:29865630-29865652 CACTGAACCCAAATGGGGTTTGG + Intronic
1146460412 17:33041768-33041790 TCCTGAACTCAGATGTGATTTGG - Intronic
1146711849 17:35048774-35048796 CACTGAAGTCAGATAGGATTTGG + Intronic
1152568834 17:81112388-81112410 CTGACAACTCAGCTGGGATTGGG + Intronic
1153272301 18:3334434-3334456 TCATCCACTCAGATGGGATTTGG + Intergenic
1153347824 18:4047568-4047590 CACCTAAGTCACATGGGATTTGG - Intronic
1153645662 18:7193994-7194016 AAATCAACTCAGATCAGATTTGG - Intergenic
1157803619 18:50641261-50641283 CACTAAATCCTGATGGGATTTGG + Intronic
1159446643 18:68548996-68549018 CACTCAACACTGATGGGATCAGG + Intergenic
1163029307 19:14533696-14533718 CTCTCAGATCAGATGAGATTTGG - Intronic
1164295543 19:23906553-23906575 CCCTGCACACAGATGGGATTGGG + Intergenic
1166434700 19:42757715-42757737 CAGTGAACACAGCTGGGATTTGG - Intronic
1166763275 19:45237820-45237842 GACACCACTCACATGGGATTCGG - Intronic
1167406894 19:49316550-49316572 CACTCAACTGTTATTGGATTAGG - Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925096349 2:1207503-1207525 CCCTCAACGCAGGTGGGATGGGG - Intronic
925550596 2:5069859-5069881 GGCTCAAATCAGATTGGATTAGG + Intergenic
926163665 2:10505053-10505075 CAGTCAGCTGAGATGGGACTGGG + Intergenic
928407505 2:31025815-31025837 CACTCAACTCTGGTTGGAGTTGG - Intronic
928848453 2:35709956-35709978 CACTCAGTTCAGGTGGGATCTGG - Intergenic
928929477 2:36609603-36609625 CACTTAAGTCAGATGGGTGTTGG + Intronic
931830447 2:66045558-66045580 GACACCACTCAGATTGGATTGGG - Intergenic
933291019 2:80438243-80438265 GACACAAATCAGATTGGATTAGG + Intronic
934607476 2:95708109-95708131 CACTCAACCCAAATGGTACTGGG + Intergenic
938375275 2:130801081-130801103 CCCTCAACTCAGATTTAATTGGG + Intergenic
1169169051 20:3449351-3449373 CACTCACCTTGGGTGGGATTGGG + Intergenic
1172520302 20:35561612-35561634 AACTCCACTCAGATGAGCTTAGG + Intergenic
1172940402 20:38650024-38650046 CTCTCCACTCAGAGGGGATGAGG + Exonic
1178627179 21:34227897-34227919 AAATCAACCCAGATGGGACTGGG + Intergenic
1181622221 22:24098942-24098964 CACTCATCTCATCTGGGCTTGGG + Intronic
1183295935 22:37029611-37029633 CACTCAACTCAGGTGGCATTTGG + Exonic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
963397100 3:144749395-144749417 CACTCAACTCACATAGGCTGAGG + Intergenic
964111905 3:153096603-153096625 GACTCCAGTCAGATTGGATTAGG - Intergenic
966964782 3:184980119-184980141 CACACAAACCAGAAGGGATTGGG - Intronic
970825477 4:20268017-20268039 CACTGAAAACAGATGGGATTGGG + Intronic
975300982 4:72791100-72791122 CACTCCAGTGAGATGGGGTTGGG + Intergenic
975340585 4:73235255-73235277 CACTCAAAGGAGATGGGAATGGG - Intronic
975546742 4:75568176-75568198 GACACAAGTCAGATTGGATTAGG + Intergenic
975790950 4:77950360-77950382 CACTCAACTCAATTGAGATGTGG + Intronic
977582855 4:98744338-98744360 AACTCATCTCAGATGGGTCTTGG + Intergenic
978232855 4:106421736-106421758 GACACAAATCATATGGGATTAGG + Intergenic
978743717 4:112167312-112167334 AACTAAACTCAGAAGGGAATGGG + Intronic
981267247 4:142801389-142801411 GACTCCAGTCAGATTGGATTGGG - Intronic
981904627 4:149907587-149907609 TACTGAGATCAGATGGGATTGGG - Intergenic
982103449 4:151990948-151990970 GACTCCAGTCAGATTGGATTAGG + Intergenic
982418634 4:155167109-155167131 CACTGGACTCAAAAGGGATTAGG + Intergenic
982771146 4:159398736-159398758 CACTCAACCAAGATAGGATATGG - Intergenic
983175535 4:164584336-164584358 CCCTAAAGCCAGATGGGATTGGG - Intergenic
986643490 5:9894079-9894101 GACACAAATCAGATTGGATTGGG - Intergenic
990508275 5:56466436-56466458 CCCTCAACCAGGATGGGATTTGG - Intronic
991140163 5:63231524-63231546 TTATCAACTCAGATGGGCTTTGG - Intergenic
991353872 5:65747851-65747873 CACTCAGCTCAGATGAGGTAAGG - Intronic
991492271 5:67194939-67194961 GACTCCAGTCAGATTGGATTAGG - Intronic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
993610952 5:90053558-90053580 AACACAAGTCAGATTGGATTAGG - Intergenic
994495649 5:100509101-100509123 CACACAAATCAGATTGGATTGGG - Intergenic
994590176 5:101761781-101761803 CCCACAACTCAGTTGGGATATGG + Intergenic
994876487 5:105429284-105429306 TACACAACTCATCTGGGATTTGG + Intergenic
996509132 5:124299394-124299416 GACCCAAGTCAGATTGGATTAGG + Intergenic
996721038 5:126630384-126630406 AAATCAACTCAGAATGGATTAGG - Intergenic
1000138279 5:158375640-158375662 TGCTCAACTCAGATGTGAATGGG - Intergenic
1000647250 5:163773705-163773727 CACTGATCTCAAATGGGAATGGG - Intergenic
1000763732 5:165258607-165258629 CACAAAACTCAGCAGGGATTTGG + Intergenic
1002920432 6:1566104-1566126 CAAACAAGTCAGCTGGGATTAGG + Intergenic
1003382498 6:5637843-5637865 GACACAAATCAGATTGGATTAGG + Intronic
1003751938 6:9068707-9068729 CACACCAGTTAGATGGGATTAGG + Intergenic
1005981658 6:30841438-30841460 CCCTCAAGTGAAATGGGATTTGG - Intergenic
1009884794 6:69613107-69613129 GACACCAGTCAGATGGGATTAGG - Intergenic
1010976073 6:82314852-82314874 CCTTCAAGCCAGATGGGATTGGG + Intergenic
1015613717 6:135053205-135053227 CACTTAATTCAGAATGGATTGGG - Intronic
1015741596 6:136460956-136460978 CAATCAACTCAGTTGCTATTGGG + Intronic
1015811677 6:137167283-137167305 AACTCATCTAAGATGGGATCAGG + Intronic
1017933754 6:158985265-158985287 CAGACGACTCAGATGGGAGTGGG + Intronic
1018433370 6:163740832-163740854 AACTCAACGCAGAGGGGAATGGG + Intergenic
1028367828 7:90054896-90054918 CACATTAGTCAGATGGGATTAGG - Intergenic
1030042860 7:105467694-105467716 TTCTCAACTCAAATAGGATTTGG - Intronic
1031476010 7:122222600-122222622 CACTTCACTCAGATAGGAATTGG + Intergenic
1033364982 7:140666202-140666224 AACTCATCTAAGATGGGATCAGG + Intronic
1033650482 7:143339005-143339027 CACTCAAAGTAGAAGGGATTTGG + Intronic
1036619755 8:10416717-10416739 CTCTAACCTCACATGGGATTCGG + Intronic
1036803587 8:11811370-11811392 CACTCAAGTCAAATGTAATTTGG - Intronic
1037581126 8:20246638-20246660 CACTGAGCTCACATGGGACTGGG - Exonic
1038127080 8:24686297-24686319 CACTGAGCTCTGATGAGATTTGG + Intergenic
1041283746 8:56238606-56238628 CTCTCAAATCAGATTAGATTGGG - Intergenic
1041685066 8:60636498-60636520 CACTGAAGTGAGATGGTATTAGG - Intergenic
1042515802 8:69657583-69657605 CATTCAGCTCTGCTGGGATTTGG + Intronic
1044308018 8:90659845-90659867 CATTCAACTCAGATGGGGAATGG - Intronic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1047345787 8:124027091-124027113 GACTCCAGTCATATGGGATTAGG + Intronic
1049268059 8:141680081-141680103 CATTCAGCTCAGATGGTGTTTGG - Intergenic
1049487732 8:142875227-142875249 CACTCACCCCAGCTGGGATGTGG + Exonic
1049492504 8:142912800-142912822 CACTCACCCCAGCTGGGATGTGG + Exonic
1050318278 9:4425435-4425457 CAGTCACCTCAGCTGGTATTGGG + Intergenic
1051455770 9:17256753-17256775 AACTCAAAGCAGAGGGGATTTGG + Intronic
1058418847 9:104816374-104816396 CAATCAACTCAGAGGGGCTTCGG + Intronic
1058750289 9:108032767-108032789 CACTCAGGTCAGAAGGGACTTGG - Intergenic
1058804389 9:108577072-108577094 AGCTCAGTTCAGATGGGATTGGG + Intergenic
1058856344 9:109066567-109066589 CACTAAACTGAAATGTGATTCGG + Intronic
1059296217 9:113273521-113273543 CACTCAGCCCAGACTGGATTAGG - Intronic
1059538064 9:115102169-115102191 CTTTGGACTCAGATGGGATTTGG - Intronic
1061750297 9:132772409-132772431 GACTCCAGTCAGATTGGATTGGG - Intronic
1185866054 X:3624971-3624993 CACTCAACTCAGATGGGATTTGG + Intronic
1189416875 X:40822985-40823007 GACTCAAATCAGTAGGGATTAGG - Intergenic
1192501959 X:71660408-71660430 CACTCAGCTCAGACGGGCTCCGG - Intergenic
1192585347 X:72314512-72314534 GCCTCAGCTGAGATGGGATTGGG - Intergenic
1194090916 X:89581259-89581281 AACCCATCTGAGATGGGATTAGG - Intergenic
1198596976 X:138247163-138247185 AACTCAAGGCATATGGGATTTGG + Intergenic
1198689585 X:139265934-139265956 CACTAAACTAAGTTGAGATTTGG + Intergenic
1199902672 X:152192404-152192426 CACTCATCACAGATGTGGTTTGG - Intronic
1200367240 X:155679784-155679806 CATTCAACTCAGATAAGATCAGG - Intergenic
1200443568 Y:3237322-3237344 AACCCATCTGAGATGGGATTAGG - Intergenic
1200779478 Y:7201450-7201472 AACTCATCTCAGGTGGGATCAGG + Intergenic
1200797770 Y:7357356-7357378 CACTCAACTCAGATGGGATTTGG - Intergenic
1201896739 Y:18999941-18999963 AACTCATCTAAGATGGGATCAGG + Intergenic
1202095336 Y:21243588-21243610 AACTCATCTCAGGTGGGATCAGG - Intergenic