ID: 1200804290

View in Genome Browser
Species Human (GRCh38)
Location Y:7416310-7416332
Sequence AGGTTTATAGAGATAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200804287_1200804290 14 Left 1200804287 Y:7416273-7416295 CCTGTCTCCAGAAAAATTTAAAA No data
Right 1200804290 Y:7416310-7416332 AGGTTTATAGAGATAGAAGAAGG No data
1200804288_1200804290 7 Left 1200804288 Y:7416280-7416302 CCAGAAAAATTTAAAAATAAATA No data
Right 1200804290 Y:7416310-7416332 AGGTTTATAGAGATAGAAGAAGG No data
1200804286_1200804290 15 Left 1200804286 Y:7416272-7416294 CCCTGTCTCCAGAAAAATTTAAA No data
Right 1200804290 Y:7416310-7416332 AGGTTTATAGAGATAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200804290 Original CRISPR AGGTTTATAGAGATAGAAGA AGG Intergenic
No off target data available for this crispr