ID: 1200806287

View in Genome Browser
Species Human (GRCh38)
Location Y:7436762-7436784
Sequence TAGGTGCTATTGGCATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200806277_1200806287 24 Left 1200806277 Y:7436715-7436737 CCCCTAAGTAACATGTCTGGAGA No data
Right 1200806287 Y:7436762-7436784 TAGGTGCTATTGGCATTGGGTGG No data
1200806278_1200806287 23 Left 1200806278 Y:7436716-7436738 CCCTAAGTAACATGTCTGGAGAT No data
Right 1200806287 Y:7436762-7436784 TAGGTGCTATTGGCATTGGGTGG No data
1200806279_1200806287 22 Left 1200806279 Y:7436717-7436739 CCTAAGTAACATGTCTGGAGATA No data
Right 1200806287 Y:7436762-7436784 TAGGTGCTATTGGCATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200806287 Original CRISPR TAGGTGCTATTGGCATTGGG TGG Intergenic
No off target data available for this crispr