ID: 1200807585

View in Genome Browser
Species Human (GRCh38)
Location Y:7448130-7448152
Sequence CAATCCCTACAGAATTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200807581_1200807585 15 Left 1200807581 Y:7448092-7448114 CCTTGAGGTTTTCTTCTGACTGG No data
Right 1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG No data
1200807578_1200807585 30 Left 1200807578 Y:7448077-7448099 CCTATGACACATCTCCCTTGAGG No data
Right 1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG No data
1200807580_1200807585 16 Left 1200807580 Y:7448091-7448113 CCCTTGAGGTTTTCTTCTGACTG No data
Right 1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200807585 Original CRISPR CAATCCCTACAGAATTCCTT GGG Intergenic
No off target data available for this crispr