ID: 1200809909

View in Genome Browser
Species Human (GRCh38)
Location Y:7473550-7473572
Sequence GGTCTTACCATTTTAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200809902_1200809909 26 Left 1200809902 Y:7473501-7473523 CCCTGAGAAAAATAGACACAACA No data
Right 1200809909 Y:7473550-7473572 GGTCTTACCATTTTAAAGGAAGG No data
1200809903_1200809909 25 Left 1200809903 Y:7473502-7473524 CCTGAGAAAAATAGACACAACAG No data
Right 1200809909 Y:7473550-7473572 GGTCTTACCATTTTAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200809909 Original CRISPR GGTCTTACCATTTTAAAGGA AGG Intergenic
No off target data available for this crispr