ID: 1200819370

View in Genome Browser
Species Human (GRCh38)
Location Y:7566526-7566548
Sequence TAGCCACCCCAAGTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200819370_1200819371 0 Left 1200819370 Y:7566526-7566548 CCAGCACTCACTTGGGGTGGCTA No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819370_1200819372 14 Left 1200819370 Y:7566526-7566548 CCAGCACTCACTTGGGGTGGCTA No data
Right 1200819372 Y:7566563-7566585 TCCAAATGGAAAGAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200819370 Original CRISPR TAGCCACCCCAAGTGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr