ID: 1200819371

View in Genome Browser
Species Human (GRCh38)
Location Y:7566549-7566571
Sequence TTGCTACATTTCTCTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200819362_1200819371 12 Left 1200819362 Y:7566514-7566536 CCTGACCCATGCCCAGCACTCAC No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819370_1200819371 0 Left 1200819370 Y:7566526-7566548 CCAGCACTCACTTGGGGTGGCTA No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819369_1200819371 1 Left 1200819369 Y:7566525-7566547 CCCAGCACTCACTTGGGGTGGCT No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819366_1200819371 6 Left 1200819366 Y:7566520-7566542 CCATGCCCAGCACTCACTTGGGG No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819361_1200819371 16 Left 1200819361 Y:7566510-7566532 CCAGCCTGACCCATGCCCAGCAC No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819364_1200819371 7 Left 1200819364 Y:7566519-7566541 CCCATGCCCAGCACTCACTTGGG No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819359_1200819371 18 Left 1200819359 Y:7566508-7566530 CCCCAGCCTGACCCATGCCCAGC No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data
1200819360_1200819371 17 Left 1200819360 Y:7566509-7566531 CCCAGCCTGACCCATGCCCAGCA No data
Right 1200819371 Y:7566549-7566571 TTGCTACATTTCTCTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200819371 Original CRISPR TTGCTACATTTCTCTCCAAA TGG Intergenic
No off target data available for this crispr