ID: 1200829699

View in Genome Browser
Species Human (GRCh38)
Location Y:7678744-7678766
Sequence CTGTGCACAGCTAATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200829696_1200829699 1 Left 1200829696 Y:7678720-7678742 CCTCGGCTTCCGACTCCAGGGCT No data
Right 1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG No data
1200829690_1200829699 30 Left 1200829690 Y:7678691-7678713 CCTACTAGCAGGGCTCTGGAAGC No data
Right 1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG No data
1200829697_1200829699 -8 Left 1200829697 Y:7678729-7678751 CCGACTCCAGGGCTGCTGTGCAC No data
Right 1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200829699 Original CRISPR CTGTGCACAGCTAATACTGC TGG Intergenic
No off target data available for this crispr