ID: 1200830798

View in Genome Browser
Species Human (GRCh38)
Location Y:7687524-7687546
Sequence TCCAGAACATTCAGGCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200830798_1200830804 27 Left 1200830798 Y:7687524-7687546 CCCAATGGCCTGAATGTTCTGGA No data
Right 1200830804 Y:7687574-7687596 GGAATTTCTACTTGTATGAAGGG No data
1200830798_1200830803 26 Left 1200830798 Y:7687524-7687546 CCCAATGGCCTGAATGTTCTGGA No data
Right 1200830803 Y:7687573-7687595 AGGAATTTCTACTTGTATGAAGG No data
1200830798_1200830801 6 Left 1200830798 Y:7687524-7687546 CCCAATGGCCTGAATGTTCTGGA No data
Right 1200830801 Y:7687553-7687575 CACTCTCTGTCTTCCTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200830798 Original CRISPR TCCAGAACATTCAGGCCATT GGG (reversed) Intergenic
No off target data available for this crispr