ID: 1200833897

View in Genome Browser
Species Human (GRCh38)
Location Y:7714123-7714145
Sequence TAGTGTATTCTGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200833897_1200833910 29 Left 1200833897 Y:7714123-7714145 CCCTGCCCCTGCAGAATACACTA No data
Right 1200833910 Y:7714175-7714197 TGCATGGCTCCTAAAGGTCCAGG No data
1200833897_1200833909 23 Left 1200833897 Y:7714123-7714145 CCCTGCCCCTGCAGAATACACTA No data
Right 1200833909 Y:7714169-7714191 GTTTGGTGCATGGCTCCTAAAGG No data
1200833897_1200833905 13 Left 1200833897 Y:7714123-7714145 CCCTGCCCCTGCAGAATACACTA No data
Right 1200833905 Y:7714159-7714181 TTGCCCCTTTGTTTGGTGCATGG No data
1200833897_1200833903 6 Left 1200833897 Y:7714123-7714145 CCCTGCCCCTGCAGAATACACTA No data
Right 1200833903 Y:7714152-7714174 GCACCTTTTGCCCCTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200833897 Original CRISPR TAGTGTATTCTGCAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr