ID: 1200834367

View in Genome Browser
Species Human (GRCh38)
Location Y:7718351-7718373
Sequence CTGGCACATTATGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200834367_1200834372 20 Left 1200834367 Y:7718351-7718373 CCCACCTCAGCATAATGTGCCAG No data
Right 1200834372 Y:7718394-7718416 GATTCACCTACTTAACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200834367 Original CRISPR CTGGCACATTATGCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr