ID: 1200834451

View in Genome Browser
Species Human (GRCh38)
Location Y:7719247-7719269
Sequence GTTCAACCAATTCCAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200834449_1200834451 -2 Left 1200834449 Y:7719226-7719248 CCCACGGCAAATATAATCACTGT No data
Right 1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG No data
1200834450_1200834451 -3 Left 1200834450 Y:7719227-7719249 CCACGGCAAATATAATCACTGTT No data
Right 1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200834451 Original CRISPR GTTCAACCAATTCCAGATAA AGG Intergenic
No off target data available for this crispr