ID: 1200835201

View in Genome Browser
Species Human (GRCh38)
Location Y:7725799-7725821
Sequence AAATAAGGGACACATGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200835201_1200835209 28 Left 1200835201 Y:7725799-7725821 CCACAGGCATGTGTCCCTTATTT No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835201_1200835210 29 Left 1200835201 Y:7725799-7725821 CCACAGGCATGTGTCCCTTATTT No data
Right 1200835210 Y:7725851-7725873 GTGACTCTCCCAACCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200835201 Original CRISPR AAATAAGGGACACATGCCTG TGG (reversed) Intergenic
No off target data available for this crispr