ID: 1200835205

View in Genome Browser
Species Human (GRCh38)
Location Y:7725814-7725836
Sequence GTGAAAGGCCCTTGTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200835205_1200835209 13 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835205_1200835217 23 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835217 Y:7725860-7725882 CCAACCTTGATGGGAGGGGGCGG No data
1200835205_1200835210 14 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835210 Y:7725851-7725873 GTGACTCTCCCAACCTTGATGGG No data
1200835205_1200835212 18 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835212 Y:7725855-7725877 CTCTCCCAACCTTGATGGGAGGG No data
1200835205_1200835213 19 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835205_1200835214 20 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835214 Y:7725857-7725879 CTCCCAACCTTGATGGGAGGGGG No data
1200835205_1200835211 17 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835211 Y:7725854-7725876 ACTCTCCCAACCTTGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200835205 Original CRISPR GTGAAAGGCCCTTGTAAATA AGG (reversed) Intergenic
No off target data available for this crispr