ID: 1200835207

View in Genome Browser
Species Human (GRCh38)
Location Y:7725836-7725858
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200835207_1200835209 -9 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835207_1200835217 1 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835217 Y:7725860-7725882 CCAACCTTGATGGGAGGGGGCGG No data
1200835207_1200835214 -2 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835214 Y:7725857-7725879 CTCCCAACCTTGATGGGAGGGGG No data
1200835207_1200835213 -3 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835207_1200835212 -4 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835212 Y:7725855-7725877 CTCTCCCAACCTTGATGGGAGGG No data
1200835207_1200835211 -5 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835211 Y:7725854-7725876 ACTCTCCCAACCTTGATGGGAGG No data
1200835207_1200835210 -8 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835210 Y:7725851-7725873 GTGACTCTCCCAACCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200835207 Original CRISPR AGAGTCACATGCGATGGTGA AGG (reversed) Intergenic
No off target data available for this crispr