ID: 1200835209

View in Genome Browser
Species Human (GRCh38)
Location Y:7725850-7725872
Sequence TGTGACTCTCCCAACCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200835206_1200835209 -2 Left 1200835206 Y:7725829-7725851 CCTTTCACCTTCACCATCGCATG No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835207_1200835209 -9 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835205_1200835209 13 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835204_1200835209 14 Left 1200835204 Y:7725813-7725835 CCCTTATTTACAAGGGCCTTTCA No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data
1200835201_1200835209 28 Left 1200835201 Y:7725799-7725821 CCACAGGCATGTGTCCCTTATTT No data
Right 1200835209 Y:7725850-7725872 TGTGACTCTCCCAACCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200835209 Original CRISPR TGTGACTCTCCCAACCTTGA TGG Intergenic
No off target data available for this crispr