ID: 1200835211 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:7725854-7725876 |
Sequence | ACTCTCCCAACCTTGATGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1200835204_1200835211 | 18 | Left | 1200835204 | Y:7725813-7725835 | CCCTTATTTACAAGGGCCTTTCA | No data | ||
Right | 1200835211 | Y:7725854-7725876 | ACTCTCCCAACCTTGATGGGAGG | No data | ||||
1200835205_1200835211 | 17 | Left | 1200835205 | Y:7725814-7725836 | CCTTATTTACAAGGGCCTTTCAC | No data | ||
Right | 1200835211 | Y:7725854-7725876 | ACTCTCCCAACCTTGATGGGAGG | No data | ||||
1200835206_1200835211 | 2 | Left | 1200835206 | Y:7725829-7725851 | CCTTTCACCTTCACCATCGCATG | No data | ||
Right | 1200835211 | Y:7725854-7725876 | ACTCTCCCAACCTTGATGGGAGG | No data | ||||
1200835207_1200835211 | -5 | Left | 1200835207 | Y:7725836-7725858 | CCTTCACCATCGCATGTGACTCT | No data | ||
Right | 1200835211 | Y:7725854-7725876 | ACTCTCCCAACCTTGATGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1200835211 | Original CRISPR | ACTCTCCCAACCTTGATGGG AGG | Intergenic | ||
No off target data available for this crispr |