ID: 1200835213

View in Genome Browser
Species Human (GRCh38)
Location Y:7725856-7725878
Sequence TCTCCCAACCTTGATGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200835205_1200835213 19 Left 1200835205 Y:7725814-7725836 CCTTATTTACAAGGGCCTTTCAC No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835204_1200835213 20 Left 1200835204 Y:7725813-7725835 CCCTTATTTACAAGGGCCTTTCA No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835208_1200835213 -9 Left 1200835208 Y:7725842-7725864 CCATCGCATGTGACTCTCCCAAC No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835207_1200835213 -3 Left 1200835207 Y:7725836-7725858 CCTTCACCATCGCATGTGACTCT No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data
1200835206_1200835213 4 Left 1200835206 Y:7725829-7725851 CCTTTCACCTTCACCATCGCATG No data
Right 1200835213 Y:7725856-7725878 TCTCCCAACCTTGATGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200835213 Original CRISPR TCTCCCAACCTTGATGGGAG GGG Intergenic
No off target data available for this crispr