ID: 1200837816

View in Genome Browser
Species Human (GRCh38)
Location Y:7750098-7750120
Sequence GCCTGGCAGATATAAACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200837816_1200837819 24 Left 1200837816 Y:7750098-7750120 CCATTGGTTTATATCTGCCAGGC No data
Right 1200837819 Y:7750145-7750167 TATATCAAACCAATAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200837816 Original CRISPR GCCTGGCAGATATAAACCAA TGG (reversed) Intergenic
No off target data available for this crispr