ID: 1200838549

View in Genome Browser
Species Human (GRCh38)
Location Y:7756406-7756428
Sequence TGCCAGAACTATGATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200838542_1200838549 10 Left 1200838542 Y:7756373-7756395 CCTGTCCCTAGCAACTGAGAGAA No data
Right 1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG No data
1200838545_1200838549 4 Left 1200838545 Y:7756379-7756401 CCTAGCAACTGAGAGAATCGGTG No data
Right 1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG No data
1200838544_1200838549 5 Left 1200838544 Y:7756378-7756400 CCCTAGCAACTGAGAGAATCGGT No data
Right 1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG No data
1200838541_1200838549 17 Left 1200838541 Y:7756366-7756388 CCAGGATCCTGTCCCTAGCAACT No data
Right 1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200838549 Original CRISPR TGCCAGAACTATGATGGGGA AGG Intergenic
No off target data available for this crispr