ID: 1200842574

View in Genome Browser
Species Human (GRCh38)
Location Y:7798112-7798134
Sequence CATTTCAGACAGAGGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200842569_1200842574 -7 Left 1200842569 Y:7798096-7798118 CCAAACCAAAACCACACATTTCA No data
Right 1200842574 Y:7798112-7798134 CATTTCAGACAGAGGCTAGGTGG No data
1200842568_1200842574 -6 Left 1200842568 Y:7798095-7798117 CCCAAACCAAAACCACACATTTC No data
Right 1200842574 Y:7798112-7798134 CATTTCAGACAGAGGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200842574 Original CRISPR CATTTCAGACAGAGGCTAGG TGG Intergenic
No off target data available for this crispr