ID: 1200843239

View in Genome Browser
Species Human (GRCh38)
Location Y:7805127-7805149
Sequence CCCCATTGGAAGGAGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200843231_1200843239 28 Left 1200843231 Y:7805076-7805098 CCAGGTAAGAGAGTCACATCATT 0: 1
1: 1
2: 14
3: 69
4: 296
Right 1200843239 Y:7805127-7805149 CCCCATTGGAAGGAGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200843239 Original CRISPR CCCCATTGGAAGGAGGGTCA GGG Intergenic
No off target data available for this crispr