ID: 1200851945

View in Genome Browser
Species Human (GRCh38)
Location Y:7892248-7892270
Sequence TAGCATTCAGTAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200851939_1200851945 23 Left 1200851939 Y:7892202-7892224 CCTGCTAGATCTAGGGAGATGGG No data
Right 1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG No data
1200851937_1200851945 24 Left 1200851937 Y:7892201-7892223 CCCTGCTAGATCTAGGGAGATGG No data
Right 1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200851945 Original CRISPR TAGCATTCAGTAGTGGTGGA TGG Intergenic
No off target data available for this crispr