ID: 1200852106

View in Genome Browser
Species Human (GRCh38)
Location Y:7893890-7893912
Sequence GTCCCACTCACTTTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200852105_1200852106 -10 Left 1200852105 Y:7893877-7893899 CCTATTAAAAGGAGTCCCACTCA No data
Right 1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG No data
1200852103_1200852106 4 Left 1200852103 Y:7893863-7893885 CCTGTGAAAAGGGGCCTATTAAA No data
Right 1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200852106 Original CRISPR GTCCCACTCACTTTGCTGAC AGG Intergenic
No off target data available for this crispr