ID: 1200854823

View in Genome Browser
Species Human (GRCh38)
Location Y:7926165-7926187
Sequence TCCAATAATCCCAATAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200854822_1200854823 22 Left 1200854822 Y:7926120-7926142 CCATGTTCTTGTGAGGCAATGAC No data
Right 1200854823 Y:7926165-7926187 TCCAATAATCCCAATAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200854823 Original CRISPR TCCAATAATCCCAATAGCAT TGG Intergenic
No off target data available for this crispr