ID: 1200854864

View in Genome Browser
Species Human (GRCh38)
Location Y:7926579-7926601
Sequence GAGTCACACAACCTAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200854861_1200854864 14 Left 1200854861 Y:7926542-7926564 CCATGTCAAATGTGAACAGGGTT No data
Right 1200854864 Y:7926579-7926601 GAGTCACACAACCTAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200854864 Original CRISPR GAGTCACACAACCTAGATGC TGG Intergenic
No off target data available for this crispr