ID: 1200855347

View in Genome Browser
Species Human (GRCh38)
Location Y:7932037-7932059
Sequence TACAATCACCAACAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200855343_1200855347 23 Left 1200855343 Y:7931991-7932013 CCCAGGCAAGAGGGTCATATCAT No data
Right 1200855347 Y:7932037-7932059 TACAATCACCAACAGAAGCAGGG No data
1200855344_1200855347 22 Left 1200855344 Y:7931992-7932014 CCAGGCAAGAGGGTCATATCATT No data
Right 1200855347 Y:7932037-7932059 TACAATCACCAACAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200855347 Original CRISPR TACAATCACCAACAGAAGCA GGG Intergenic
No off target data available for this crispr