ID: 1200855435

View in Genome Browser
Species Human (GRCh38)
Location Y:7932895-7932917
Sequence TGTCACTGGGACCATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200855435_1200855441 14 Left 1200855435 Y:7932895-7932917 CCTGGGTGATGGTCCCAGTGACA No data
Right 1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG No data
1200855435_1200855438 0 Left 1200855435 Y:7932895-7932917 CCTGGGTGATGGTCCCAGTGACA No data
Right 1200855438 Y:7932918-7932940 TATGTAAAATTTCCCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200855435 Original CRISPR TGTCACTGGGACCATCACCC AGG (reversed) Intergenic
No off target data available for this crispr