ID: 1200855436

View in Genome Browser
Species Human (GRCh38)
Location Y:7932908-7932930
Sequence GAAATTTTACATATGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200855436_1200855441 1 Left 1200855436 Y:7932908-7932930 CCCAGTGACATATGTAAAATTTC No data
Right 1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200855436 Original CRISPR GAAATTTTACATATGTCACT GGG (reversed) Intergenic
No off target data available for this crispr