ID: 1200855441

View in Genome Browser
Species Human (GRCh38)
Location Y:7932932-7932954
Sequence CTTTGAAGGCAGAGCCACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200855437_1200855441 0 Left 1200855437 Y:7932909-7932931 CCAGTGACATATGTAAAATTTCC No data
Right 1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG No data
1200855435_1200855441 14 Left 1200855435 Y:7932895-7932917 CCTGGGTGATGGTCCCAGTGACA No data
Right 1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG No data
1200855436_1200855441 1 Left 1200855436 Y:7932908-7932930 CCCAGTGACATATGTAAAATTTC No data
Right 1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200855441 Original CRISPR CTTTGAAGGCAGAGCCACGA TGG Intergenic
No off target data available for this crispr