ID: 1200857856

View in Genome Browser
Species Human (GRCh38)
Location Y:7958802-7958824
Sequence GTCCACCTCCACCACAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200857856_1200857864 4 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857864 Y:7958829-7958851 ATTGTACTGGGACAGGAGGAGGG No data
1200857856_1200857869 20 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857869 Y:7958845-7958867 AGGAGGGGGTAATTGGCACTGGG No data
1200857856_1200857866 6 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857866 Y:7958831-7958853 TGTACTGGGACAGGAGGAGGGGG No data
1200857856_1200857868 19 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857868 Y:7958844-7958866 GAGGAGGGGGTAATTGGCACTGG No data
1200857856_1200857871 27 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857871 Y:7958852-7958874 GGTAATTGGCACTGGGTTGTGGG No data
1200857856_1200857867 13 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857867 Y:7958838-7958860 GGACAGGAGGAGGGGGTAATTGG No data
1200857856_1200857862 0 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857862 Y:7958825-7958847 AGGCATTGTACTGGGACAGGAGG No data
1200857856_1200857859 -9 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857859 Y:7958816-7958838 GAGGTGGACAGGCATTGTACTGG No data
1200857856_1200857860 -8 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857860 Y:7958817-7958839 AGGTGGACAGGCATTGTACTGGG No data
1200857856_1200857863 3 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857863 Y:7958828-7958850 CATTGTACTGGGACAGGAGGAGG No data
1200857856_1200857861 -3 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857861 Y:7958822-7958844 GACAGGCATTGTACTGGGACAGG No data
1200857856_1200857865 5 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857865 Y:7958830-7958852 TTGTACTGGGACAGGAGGAGGGG No data
1200857856_1200857870 26 Left 1200857856 Y:7958802-7958824 CCTATCCTGTGGTGGAGGTGGAC No data
Right 1200857870 Y:7958851-7958873 GGGTAATTGGCACTGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200857856 Original CRISPR GTCCACCTCCACCACAGGAT AGG (reversed) Intergenic
No off target data available for this crispr