ID: 1200858493

View in Genome Browser
Species Human (GRCh38)
Location Y:7964908-7964930
Sequence TATAATCCCCAGTGGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200858490_1200858493 22 Left 1200858490 Y:7964863-7964885 CCAGGCAAGAGAGTCATATTGTT No data
Right 1200858493 Y:7964908-7964930 TATAATCCCCAGTGGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200858493 Original CRISPR TATAATCCCCAGTGGAAGCA GGG Intergenic
No off target data available for this crispr