ID: 1200859437

View in Genome Browser
Species Human (GRCh38)
Location Y:7974719-7974741
Sequence GAGTCACACAACCTGAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200859433_1200859437 28 Left 1200859433 Y:7974668-7974690 CCGAAATACAGCAAAATTCCTGT No data
Right 1200859437 Y:7974719-7974741 GAGTCACACAACCTGAGTACTGG No data
1200859432_1200859437 29 Left 1200859432 Y:7974667-7974689 CCCGAAATACAGCAAAATTCCTG No data
Right 1200859437 Y:7974719-7974741 GAGTCACACAACCTGAGTACTGG No data
1200859436_1200859437 10 Left 1200859436 Y:7974686-7974708 CCTGTTCATGGGCACTCTTTAGC No data
Right 1200859437 Y:7974719-7974741 GAGTCACACAACCTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200859437 Original CRISPR GAGTCACACAACCTGAGTAC TGG Intergenic
No off target data available for this crispr