ID: 1200861088

View in Genome Browser
Species Human (GRCh38)
Location Y:7993641-7993663
Sequence CTGTAGCACTTCATTAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200861087_1200861088 24 Left 1200861087 Y:7993594-7993616 CCATCATTAAAGTGACAACAAAT No data
Right 1200861088 Y:7993641-7993663 CTGTAGCACTTCATTAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200861088 Original CRISPR CTGTAGCACTTCATTAATTA AGG Intergenic
No off target data available for this crispr