ID: 1200862347

View in Genome Browser
Species Human (GRCh38)
Location Y:8006420-8006442
Sequence CTAAAATTACCAAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200862344_1200862347 21 Left 1200862344 Y:8006376-8006398 CCAAACAAGAAATTCATATCATT No data
Right 1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG No data
1200862343_1200862347 22 Left 1200862343 Y:8006375-8006397 CCCAAACAAGAAATTCATATCAT No data
Right 1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200862347 Original CRISPR CTAAAATTACCAAAGGAAGC AGG Intergenic
No off target data available for this crispr